Down the PCR Rabbit Hole
Last December I sent off some specimens to get sequenced by the Fungal Diversity Survey (FunDiS). I carefully followed their protocols and got back some excellent reports through BOLD systems. When I got the reports back in April of 2021, it started an avalanche of new opportunities and really opened up my world to what it could really mean to be a Citizen Scientist.
Through those 7 sequences, I have been swept up in a flurry of chain emails from mycologists, herbariums and opportunities to learn more than I ever thought I could. FunDis gave our group WVMS Funga a grant to sequence some fungi which we are diligently collecting and cataloging to send off to them. In addition I got the opportunity to send off my Ascomycete collection to get sequenced and be a part of the Pezizales study at the University of Florida Herbarium, through Dr. Matt Smith. I was beyond excited when I was awarded those opportunities to contribute to the study of mushrooms. But I wanted more.
I began looking into doing DNA amplification at home, in my own studio. I followed Sigrid Jakob's videos and watched everything I could that Alan Rockefeller made and then started sourcing equipment. I am happy to say that I now have a thermal cycler and centrifuge in my studio and have started up a conversation on a Facebook forum to gather my remaining supplies. After some suggested reading and lots of encouragement I feel more and more capable every day. I am still very new at this, but will try and learn everything I can from the mentors that are willing to teach.
Being a part of this community of scientists working so hard to build a database of knowledge gives me a purpose and I am so happy to contribute to something bigger. My dedication to mycology is only getting stronger as time passes.
Observaciones
Fotos / Sonidos
Qué
Hongos de Copa, Morillas Y Parientes (Orden Pezizales)Observ.
autumnaDescripción
I found this little black cup fungi growing through the woods at the McDonald Dunn Research Forest on March 12th. The first specimen I found was a grouping of them clustered together on a Douglas fir cone, the others I found in clusters or scattered on a hillside, on wood, and on hummus and moss. The specimens were not growing out of the wood or cone, but rather in a matted group laying on top of these hosts. The cups ranged in size but the largest I found was 11mm wide, and a cap depth of 5mm. When I peeled the specimens off of the wood and moss, there was a mat of hairs that spread out below the cup. There was no real stipe, just this mat of hairs.
The outside of the cup was very hairy and inside was a shiny black. When cut, the flesh was white. The cup was tough, and not so brittle or fragile.
The spores were set in an 8 spore asci, inamyloid, and are globose.
The weather was dry for about 4 days before, in 30's and 40's.
Sequenced by FunDiS on 3/3/21
Nucleotide Sequence
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATTAACTGCGAAATGCGTGTGTCTCTCGTAAGTCTGCAGTGTTTCTTCTGGGGACTCTGCAGCGCTGGTCCTCGCCTCCTTTTAGTTATATCCCATCTGTGAACTTATCCACTGTTGCTTCCGTGAGCCTGCTGTTCACACTCTCTGAGAGTGAACGCCTGAAAAGCCCTAGCCATACTTAGGGGCGCACGGCAATGGTACTACAACTCTGGTTTTATGTCTTCCATGTCTGAGTGGTAAACACATCAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATCAAACCATCCTCAAGCAACCTTGCTTGGTCGTGGAGGAAGATGATTTCCAGATCATCCCCTCTGGAATTTCTCAGCCGAGACCGCAATAACCTCAGGTGTGATAACATTACCTCGCTTGAAGGTTGTGGCGAGCTCTTGCTGTATAGAACCCCCCAGCATTTACCATGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA
Fotos / Sonidos
Observ.
autumnaDescripción
Found this small scatter group of earth tounges in the duff in a Douglas fir forest. They were about 9 cm tall and the "head" was 8mm wide. I had a really hard time figuring out what I was seeing microscopically. But after reading a few books, I figured out the elongated things were not paraphyses, but the actual spores! How interesting. I saw some of them in asci sort of overlapping each other, but wasn't able to count the 8 spores in the asci.
It was about 40 degrees outside and had been raining the previous 4 days.
Sequenced on 3/3/21 by FunDiS:
Nucleotide Sequence
AGTCCTTCCGTGGGTAACGCTTGCTGAAGCCTTAGCAGCCCGAAAGGGTGGCCTTTGACGACTATAAACAACTAGAGAGCCTGAAATGCTAGTTCACAGAAGAAAATTTGTGGGCAACACTGTCAAATTGCGGGAAAACCCTAAAGACCTTGACACCAAGCGTCTGCTGGAAACGGCGGCGTGGCCGAGCTAATTGCCCTGGGTATGGTAAAAGTTCAAGGTATGAGCCTGAGTGATCGGGTGAAATGGGCGATCTGCAGCCAAGTCCTAAGGCCTACATAGGCTATGGATGCTGTTCACAGGCCAAATGGCAGTGGGTGGGAAGTGGATATTTTTTTACCTTCCTGCTTAAGATATGGTCGGTCCTCCTGCGAAAGCTGGAGGGTTAAGTTTACCCCCCAAATAGAAGAGAGAGCATCTATAATGCAGTTGCCTTTGCTGGCTATTCTCTCAGAACATAACGTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTTAGGGTCCCTTGTGGGCCCAAACCTCCAACCCCCTATTGGTGTTTACTACCCTGTTGCTTCGGCAGGCCCCAATGGGTTTACCTGCCGGAGCCTTAGTATAACAATCTGTTTAATGAATTGGTTAGTCTGATCCTTCTGGGAAAAACATAGAATTGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTGCACAATCTCTCAAGCCTAGCTTGGGGTGTTGGGTCTTCGTCCTTCCCTCCCTCTCTACTGTTCGGGTAAGGGGGAGAGGACCCGGACGTACCTAAAAATTAGTGGCGGTGCCCATGTTGGTCTCAAGCGTAGCAGACTCTCTCTCGCTTTGGATGACCTGTCATGTTAGCCCACCAGCCCCTGCATGTATGCATGCATCTTAACTAAGGTTGACCT
Fotos / Sonidos
Observ.
autumnaDescripción
This Ascomycete cup fungi is really interesting, but I can't quite figure out what it is. The fruiting bodies are a grayish brown on the abhymenium surface and a light brown surface on the hymenium surface. All of the fruiting bodies have a hole in the top center that is kind of jagged. The cup is deep and goes into a V shape near the stipe. The stipe is rudimentary and ends in a stringose base. They were fruiting in scattered groups and seemed to be various ages. I did not find any with their cups fully opened, so I am not sure they would form a true goblet shape.
The spores were elliptical about a 3:1 ratio and rough looking or textured on the outside of the spore. There was no amyloid reaction in Melzer's.
Width of 22mm
Length of specimen 6cm
Top to base 36mm
hole 10mm
This specimen is smooth and dry, and it was not hairy.
Sequenced on 3/3/21 through FunDiS:
Nucleotide Sequence
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACACAATACTCTGTATTATCCACACACACCTTCTGTGATCCATTTACCTGGTTGCTTCCCGTGGCATCTCGCTTGCTTCAGAGGCCCCTGCCTTCCTGCGTGGGAGGGCAGGTGTGAGCTGCTGCTGGGCCCCCCGGGACCACGGGAAGGTCCAATGAAACCCTGGTTTTTTGATGCCTTCAAGTCTGAAATTATTGAATACAAGAAAACTGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCACGCCTGTTCGAGCGTCATTAAGTCAACCCTCAAGCCTCCTTTGGTTTGGTCATGGAACTGAACGGCCGGACCCGCTTGGGATCCGGTCGGTCTACTCCGAAATGCATTGTTGCGGAATGCCCCAGTCGGCACAGGCGTAGTGAATTTTCTATCATCGTCTGTTTGTCCGCGAGGCGTTCCCGCCCACCGAACCCAATAAACCTTTCTCCTAGTTGACCTCGAATCAGGTGGGGATACCCGCTGAACTTAA
Fotos / Sonidos
Observ.
autumnaDescripción
These little black cups had me scratching my head for a while, until I looked at those globose spores! I knew I had seen those before. A few months ago I found P. vogesiaca near this spot. And I saw larger flushes all over the forest now. But these little cups were so small and black, I thought they were something else.
Fotos / Sonidos
Observ.
autumnaDescripción
I found this specimen fruiting next to some Pseudoplectania vogesiaca, but when I looked at the spores they look like the other P. nannfeldtii that I found the week before. This specimen was not attached to the stick, instead it was growing in the dirt beside the stick and the moss had attached the mushroom to it.
Fotos / Sonidos
Observ.
autumnaDescripción
I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.
Sequenced on 3/3/21 by FunDis:
Nucleotide Sequence
CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT
Comentarios
Agregar un comentario