Hynobius of South Korea

Hynobius, a South Korean habitat, is not easy to distinguish species by their outer form. You may be able to see the teeth of the palate by dissection, but salamanders die.
The best way is to analyze the mitochondrial DNA. Currently, four species have Korean names and the other four have not yet been named. HC1, HC3 was first released in 2008 by Baek Hye-jun. Below are the eight Hynobius Salamander DNA sequences.

>hynobius_leechii
GCCGGGATAGTGGGCACCGCCTTAAGTCTCTTAATTCGAGCTGAGTTAAGCCAACCCGGGACTCTTCTT
GGAGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACC
AGTAATAATTGGGGGTTTTGGAAATTGACTAGTTCCATTAATAATCGGCGCCCCGGATATAGCATTTCCA
CGAATAAATAATATAAGTTTTTGGTTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
GGCCGGAGCAGGGACAGGCTGAACCGTTTATCCACCATTAGCGGGTAACTTAGCACATGCCGGGGCTT
CGGTTGATTTAACAATTTTTTCGCTACATTTAGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATT
ACAACTTCCATTAATATAAAACCCTCGTCGATATCGCAGTATCAAACACCCTTATTTGTATGATCTGTGTT
AATTACTGCTATTCTTCTTTTACTATCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTAACAGACC
GAAACCTAAACACTACATTCTTCGACCCTGCGGGGGGAGGTGACCCTGTTCTTTACCAGCACTTGTTTT
GATTTTTTGGTCATCCAGAGGTTTAT

>Hynobius_yangiI
GCCGGAATAGTGGGTACCGCCCTAAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGAACTCTCCTT
GGGGATGACCAGATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACC
AGTAATAATTGGGGGCTTCGGAAATTGGTTGGTGCCATTAATAATCGGCGCCCCAGATATAGCATTTCCG
CGAATAAATAATATAAGTTTTTGACTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
GGCCGGAGCAGGAACAGGCTGGACCGTCTATCCACCATTAGCAAGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTTTCACTGCATTTAGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATC
ACAACTTCCATTAATATAAAACCCTCCTCAATATCACAATACCAAACACCCTTATTTGTCTGATCTGTATT
AATTACTGCTATTCTTCTTTTATTATCTTTACCAGTCCTTGCTGCAGGGATCACAATACTTCTAACAGACC
GAAACCTAAACACTACATTCTTCGACCCCGCAGGTGGAGGTGACCCTGTTCTCTACCAACACTTATTTT
GATTTTTTGGTCACCCAGAGGTTTAT

>Hynobius_quelpaertensis
GCTGGGATAGTTGGCACTGCCTTAAGTCTCCTAATTCGAGCCGAACTAAGCCAGCCTGGGACTCTTCTC
GGGGATGACCAGATTTATAATGTGATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATGGTAATGCC
AGTGATAATCGGGGGCTTCGGAAATTGGTTAGTCCCATTAATAATCGGCGCCCCGGACATAGCATTTCC
ACGAATAAATAACATAAGTTTTTGGCTATTACCCCCGTCATTTCTTTTATTACTAGCATCATCTGGGGTTG
AAGCTGGAGCAGGAACAGGCTGAACCGTTTATCCCCCACTAGCAGGTAACTTAGCACATGCTGGAGCT
TCAGTTGATTTAACAATTTTTTCACTACACTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTAT
TACAACCTCCATTAATATAAAACCCCTATCAATATCCCAATATCAAACACCTTTATTTGTTTGATCCGTATT
AATTACTGCTATTCTTCTTTTATTATCTTTACCAGTCCTTGCCGCAGGAATCACAATACTCCTAACAGACC
GAAACCTAAATACTACATTCTTCGACCCTGCAGGAGGAGGTGATCCCGTTCTCTATCAACATTTATTTTG
ATTTTTTGGTCACCCAGAGGTCTAT

>HC1
GCTGGGATAGTGGGCACTGCCCTAAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGAACTCTTCTC
GGAGATGACCAAATTTATAATGTAATTGTAACTGCTCACGCATTCGTAATAATTTTTTTTATAGTAATGCC
AGTAATAATTGGAGGTTTTGGAAATTGGTTGGTTCCATTAATAATTGGTGCCCCAGACATAGCATTCCCG
CGAATAAATAACATAAGTTTTTGGCTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
AGCCGGAGCAGGAACAGGCTGAACCGTTTACCCCCCACTGGCAGGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTCTCACTACACTTAGCAGGTATTTCATCAATTTTAGGAGCAATTAATTTTATT
ACAACCTCTATTAATATAAAACCCTTGTCAATATCGCAATACCAAACACCTTTATTTGTTTGATCAGTACT
AATCACTGCTATTCTTCTTTTACTGTCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTGACAGAC
CGAAACCTAAATACTACATTCTTCGACCCAGCGGGGGGAGGTGATCCTGTTCTCTATCAACACTTGTTT
TGATTTTTTGGTCACCCAGAGGTCTAT

>Hynobius_unisacculus_HC2
GCCGGAATGGTGGGCACTGCCTTGAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGATCTCTTCTC
GGTGATGACCAAATTTATAATGTAATTGTAACTGCTCACGCATTCGTAATAATTTTTTTTATGGTAATACC
AGTAATAATTGGGGGTTTCGGAAATTGATTAGTTCCATTAATAATTGGTGCCCCGGACATAGCATTTCCC
CGAATAAATAATATAAGTTTTTGGCTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
AGCTGGAGCAGGAACAGGCTGAACCGTTTACCCCCCACTGGCAGGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAATTTTATT
ACAACCTCCATTAATATAAAACCCCTGTCAATATCGCAGTACCAGACACCTCTGTTTGTTTGATCAGTATT
AATTACTGCTATTCTTCTTTTACTATCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTAACAGACC
GAAACCTAAATACTACATTCTTCGACCCGGCGGGGGGAGGTGACCCTGTTCTCTATCAACATTTATTTTG
ATTTTTTGGCCACCCTGAGGTTTAT

>HC3
GCCGGGATAGTGGGCACCGCCCTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGAACCCTTCTT
GGGGATGATCAAATTTATAACGTAATTGTGACCGCCCACGCATTTGTGATAATCTTTTTTATAGTAATACC
AGTAATAATTGGAGGCTTCGGGAATTGGTTAGTTCCATTAATAATTGGCGCCCCAGATATAGCATTTCCA
CGAATAAACAATATAAGTTTTTGACTATTACCCCCATCATTTCTCTTATTACTAGCATCATCCGGGGTTGA
AGCTGGGGCGGGAACAGGCTGAACCGTTTATCCGCCCCTGGCAGGTAATTTAGCACATGCCGGAGCCT
CAGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCGTCAATTCTAGGGGCAATTAACTTTATT
ACAACTTCCATTAATATAAAACCCTCATCAATATCGCAATATCAAACACCCTTATTTGTTTGATCTGTATT
AATTACTGCTATCCTTCTTTTACTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GAAACCTAAATACTACCTTCTTCGACCCCGCAGGGGGAGGCGACCCCGTTCTCTACCAACACCTATTTT
GATTTTTTGGTCACCCAGAGGTTTAT

>HC4_Changwon
GCCGGAATAGTGGGCACTGCCCTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACCCTCCTC
GGTGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACCA
GTAATAATTGGGGGTTTCGGAAATTGGTTAGTTCCGTTAATAATTGGCGCCCCAGATATGGCATTTCCAC
GAATAAATAATATAAGTTTCTGATTATTACCCCCATCATTTCTTTTACTATTAGCATCATCCGGAGTTGAG
GCTGGAGCAGGAACAGGCTGAACCGTTTACCCACCACTAGCGGGTAACTTGGCACATGCCGGAGCCT
CGGTTGATTTAACAATTTTTTCGTTGCATTTAGCAGGTATCTCATCAATTCTAGGAGCAATTAACTTCATC
ACAACCTCCATTAACATAAAACCCTCATCAATATCGCAATATCAAACACCCTTATTTGTCTGATCTGTACT
AATTACTGCTATCCTTCTTTTACTGTCTTTACCAGTTCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GGAACCTAAATACCACATTCTTCGACCCTGCAGGGGGAGGTGACCCTGTTCTCTACCAACACTTGTTTT
GATTTTTTGGCCACCCAGAGGTTTAT

>HC5_BoSung
AGCTGGATAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCAAATTTATAATGTAATTATAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACA
AGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCC
GCGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTG
AAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGC
CTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTA
TTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTAT
TAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGAC
CGAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTT
TGATTTTTTGGTCACCCTGAAGTTTAA

>HC5_YoungAm
CCCTGGATAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCACATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATATTTTTTTTTATAGTAATACCA
GTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCCG
CGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTGA
AGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGCC
TCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTAT
TACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTATT
AATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTTT
GATTTTTTGGTCACCCTGAAGTTTAA

>HC5_GoHeung
CGCTGGAAAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACC
AGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCC
GCGAATGAATAACATACGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTG
AAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGC
CTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTA
TTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTAT
TAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGAC
CGAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTT
TGATTTTTTGGTCACCCTGAAGTTTAA

Publicado por pintail pintail, 01 de abril de 2018

Comentarios

No hay comentarios todavía.

Agregar un comentario

Acceder o Crear una cuenta para agregar comentarios.

¿Esto es inapropiado, spam u ofensivo? Agregar una marca