Diario del proyecto Marine Biodiversity of Southern Sydney Harbour

Just an update that the running contest dates based on the submission of photographs to iNaturalist will be extended to August 1, 2023 in the interest of giving a fair shake to as many participants (new and old) as possible. As a reminder, small prizes, including gift vouchers from local dive providers (Sydney Dive Charters, Dive Centre Bondi, PRO DIVE ALexandria) and restaurants (Clove Lane, Randwick), will be awarded to top users at each of the three sites in the categories below, on or just after August 1, 2023.

Archival Photos: eligibility period based on photos taken prior to June 1, 2022. This category is particularly well suited to avid snorkelers, SCUBA divers, and underwater photographers that regularly visit one or all three of the sites in southern Sydney Harbour.

*New Photo Submissions: eligibility period based on photos taken between October 15, 2022 and August 1, 2023. This category is well suited to anyone with a keen eye and underwater camera!

*Note that the contest for “New Photo Submissions” at Shark Beach will only start when it reopens to the public due to current lack of access.

This journal post was written by project leader and iNaturalist member, joseph_dibattista Dr Joseph DiBattista.

Who doesn't love a good shark photo? We have now completed our fourth month of the Marine Biodiversity of Southern Sydney Harbour project and I'd like to congratulate user eschlogl (once again!) for his Photo Observation of the Month of a Port Jackson Shark (Heterodontus portusjacksoni) from Camp Cove. Despite being an avid diver in Sydney for 25 years, this is the first time Erik observed juvenile Port Jackson Sharks here. Port Jackson Sharks usually live in rocky environments on, or near, the sandy/muddy bottom. In some instances they may be resting ajacent to seagrass meadows. This species occurs in southern Australian waters from southern Queensland south to Tasmania and west to the central coast of Western Australia. In fact, genetic studies suggest that there may be two populations in Australia, one occurring from southern Queensland to New South Wales and the second from north-eastern Victoria to Western Australia. These sharks have an oviparous reproductive mode, meaning that they lay eggs, in this case dark brown spiral egg cases that hatch after approximately one year. The female actually manipulates the egg case in her mouth once laid to attach it to rocks and crevices in order to anchor it in place. This species is not to be confused with the the Crested Hornshark (Heterodontus galeatus), which has large prominent crests above the eyes and lacks dark markings on its side.

This journal post was written by project leader and iNaturalist member, Dr Joseph DiBattista.

We have now completed our third month of the Marine Biodiversity of Southern Sydney Harbour project and I'd like to congratulate user nikihubbard (once again!) for his Photo Observation of the Month of a putative Striate Anglerfish (Antennarius striatus) from Parsley Bay. This observation still needs a confirmed ID and so please do hop on the platform and provide some feedback to get it to Research Grade. Anglerfish have extraordinary adaptations including a lure for attracting their prey, a large mouth, and hidden gill openings. Anglerfishes "fishing lure" is comprised of a stalk (the illicium) and a bait (the esca), which resembles potential prey. For identiftication purposes, do not be fooled by their colouration as this can be extremely variable. Indeed, some are heavily striped, while others have broken stripes or spots, or lack stripes entirely.

This journal post was written by project leader and iNaturalist member, Dr Joseph DiBattista.

Given that we are now well and truly stuck into the Marine Biodiversity of Southern Sydney Harbour project, I thought that I would share our updated biodiversity audit results based on environmental DNA (or eDNA) technologies. As mentioned previously, eDNA can be thought of as genetic “breadcrumbs” left behind in the environment that can identify every living thing, from microbes to mammals, and boy did we pick up a lot of breadcrumbs with our seawater sampling at Parsley Bay (Vaucluse) and Camp Cove (Watsons Bay) over the course of the last five months. This was all thanks to DNA sequencing provided by our friends at Wilderlab in New Zealand (https://www.wilderlab.co.nz/). Feel free to look through the "explore" tab on their webpage to view our sampling data populated on their map. Also feel free to view all the amazing flora and fauna that were detected at each of these locations. Please refer to previous journal posts on the nitty gritty details of how this eDNA technology all works.

Based on the “Wheels of Life” you see here constructed for Parsley Bay and Camp Cove, we detected 74 and 85 species of fish (with approximately 70% faunal overlap), respectively, with some of the more interesting (cryptic species) detections including the Southern Velvetfish, Pink Clingfish, Ringscale Threefin, Rosy Weedfish, and the Mother-of-Pearl Pipefish. Links to information on each these fishes are provided below. These detections were in addition to hundreds of species of molluscs, worms, crustaceans, rotifers, cnidarians, fungi, sponges, insects, plants, algae, diatoms, ciliates, birds (ducks, shags, and all that jazz), mammals, bacteria, and so much more! We are even detecting DNA shed by some of the feral terrestrial animals that likely utilize the surrounding area (rats and foxes). Stay tuned for more updates on the eDNA project in March.

https://fishesofaustralia.net.au/home/species/2171

https://fishesofaustralia.net.au/home/species/4131

https://fishesofaustralia.net.au/home/species/16

https://fishesofaustralia.net.au/home/species/8

https://fishesofaustralia.net.au/home/species/3197

This journal post was written by project leader and iNaturalist member, joseph_dibattista Dr Joseph DiBattista.

We have now completed our second month of the Marine Biodiversity of Southern Sydney Harbour project and I'd like to congratulate user nikihubbard for his Photo Observation of the Month of a Fanbelly Leatherjacket (Monacanthus chinensis) from Parsley Bay. It is also our most observed species in the project to date. This fish species can be recognised by the large skin flap on the belly, the concave snout profile, the caudal filament, and by the triangular profile of the back. These fish are often seen maintaining position along the edge of the swimming net at Parsley Bay. Note that it's colouration can often change to match its surrounding environment, whether that be an oyster bed, seagrass, or sandy patch. This species is not just restricted to Australia but found more broadly to Malaysia and southern Japan, through Indonesia and Samoa.

This journal post was written by project leader and iNaturalist member, Dr Joseph DiBattista.

We have just completed our first month of the Marine Biodiversity of Southern Sydney Harbour project and I'd like to congratulate user eschlogl for his Photo Observation of the Month of a Southern Calamari Squid (Sepioteuthis australis) from Camp Cove. In addition to being an amazing photo, it fits in with our aim of encouraging iNaturalist users to submit archival photos taken at some of these sites, in this case throwing it back to 1999! This squid species has a varied colour pattern, ranging from light to dark brown in this case, with diamond-shaped fins that extend the whole length of the body. It prefers shallow inshore waters, often associating with reefs, sand, and seagrass beds. Males use spectacular courtship displays and females lay their eggs in finger-like strings of 2-6 eggs at the bases of weed and seagrass.

This journal post was written by project leader and iNaturalist member, Dr Joseph DiBattista.

As my first journal post, I thought that I would explain a little about a new biological monitoring tool based around DNA sequencing technologies and environmental DNA (or eDNA) that we are using in this project to compliment your in situ underwater observations uploaded here to iNaturalist. eDNA can be thought of as genetic “breadcrumbs” left behind in the environment that can identify every living thing, from microbes to mammals, thus fixing a more holistic lens on ecosystem health and function. Inside the cells of organisms lies a genetic code, and individual plants and animals shed tens of thousands of these cells into our oceans each day as they go about their business.

Capturing these breadcrumbs is as easy as filtering some of the seawater sampled at a coastal or marine site of particular interest, extracting the DNA in the filtrate, sequencing that DNA, and then assigning these DNA barcodes to specific species, akin to a barcode on supermarket items that can identify your snack purchases. These barcodes are small segments of DNA distinguished by the order and composition of A’s, T’s, C’s, and G’s. For example, one of the common fishes observed in Parsley Bay is Luderick (Girella tricuspidata), whose unique DNA barcode at the eDNA assay that we are using is: CTGGCCTTAAACATTGATGGCACGATACAACCGCCATCCGCCTGGAAACTACGAGCACCAGCTTGAAACCCAAAGGACTTGGCGGTGCTTTAGATCCAC. This DNA barcode is very different from that of any other fish, including the four, other closely related Australian species in the Girella genus, some of which are similar in appearance.

Here I am sharing a sneak peek at the organisms assigned to our very first eDNA samples collected at two locations in Parsley Bay (Vaucluse) and two locations in Camp Cove (Watsons Bay) processed by our friends at Wilderlab in New Zealand (https://www.wilderlab.co.nz/). You can see on their “Wheels of Life” that because we are using a number of different genetic tests, we can reveal plants and animals across the tree of life each time that we sample seawater at these sites. You can explore each individual sample and the organisms revealed in greater detail here.